Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AE0779
Clone ID AE0779
Vector pGT0lxr
Project sanger

Sequence tag AE0779
Sequence
ACAACAGCCGGCGCCAGCTGTTCCGCACCAAGAGCAAGCGCCGTTTCTTCTTCCGGGTGTCTGATGAGCTGCGACAGCAG
CAGCGCAGGGAGATGCTGAAGGACCCTTTTGTGCGCTCCAAGTTCATCTCGCCGCCCACCAACTTCAACCACCTGGTGCA
CGTGGGCCCTACGGAGGGAAGGCCCAACACCAGGGATGGGACCCGGGCTCAGGAACAGAAGAGCAGAGGTGCCCGCAGCT
CCGGGCGGCAGCGGCCCCACAGCTTCTCAGAGGCATTTCGGCGGCCAGTGTCCACGGGCAGTGATGGTCTCCGTGGAGAA
ACAGACCCATTAGTGAAGAGGAAACCTTGGACATCTCTGTCCAGCGAATCAGTGTCCTGCCCCCAGGGGTCCCTGAGCCA
AGCAGCTTGGAATTCATGGGAAGAGGAACCGAAAGTCCCATATGGG
Sequence Type mRNA
Unitrap ID UNI2877

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 6322060..6322868 122
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024769 (Cdc42bpg) CDC42 binding protein kinase gamma (DMPK-like) Gene [Source:MGI (curated);Acc:Cdc42bpg-001]

 
Come back to gene ENSMUSG00000024769


For any suggestions or comments, please send an email to unitrap@crg.es