Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15049G11
Clone ID IST15049G11
Vector VICTR80
Project tigm

Sequence tag IST15049G11BBF1
Sequence
CTTTTAACTGAACTCAACAAAACTGAACATAGCTAACCACCACCAGGCTTGCATCGACATAGCTGAGACAGGGATGCAAG
CCCACCCTGACTCAGTTCTCAGTGTGTCTTCTCTGGGGATTCCAAATGGGGTTCTAAAACATGCTACAGTATTTGAGAGA
CTAAGCTCCTGCAGTGGTGTCCTCATTTGCACATCATTACATATCCCACCTCTTGCCTTCCTCAGGGAATACTTCTCAAC
TCTTAGTTTTAGCAACAGCTACTGGACAAGGACAGGCTGTTTTCTACTTTAGACAAAGTTATTGTGATTTCCCCTAATAA
AATAATAAGGAACAGAATATCAATGTCCAGGCAAACAAAACAAATTTTTTTTCAAGTCAGGANTTCCTCAAACCCCATCT
GANAGNNTCCCCCTCTTAACCCTTTGTTGAGNNTCTGTAGGGGCNCCANAAAGGCTGGGCTACTGGGGAAAATNNCTGGC
TGCTGGCNNGCGTACNCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65532067..65532566 470
NO GENE  


Sequence tag IST15049G11HMR1
Sequence
AAANNAACTTTACACCANCAAANNNNGCACCATTTCAGTGAGGAAAAAAGCCCCAATTTCCAGCAAATATTGATTTCTGT
AGTGTAGATATACTACACACACTTGGCTGGTTCAACACTGATAACAGTTGTGTAGGGAGCTGGCTGTAGCACTCCCACTC
ACTGCTTCTAGTTTCCCTGTGTGGCACTGTGTTGTAGCTATGGGACAGGTCTGCTGTTGAGTAATGATACACACCACAGA
TTTCCTCTTTCCCTGCCATTAAGCCAGAACCAAAGATGGCAATAGTTTTGTGTTTTCCTGAAAATTAACGTGGCCTTCAG
CCAGGAGTGGTGGTGAACACCTTTAATCCCAGCACTTAGAAAGCAGAGGCAGGCATACCTCCTAGTTCAAGGCCNGCCCG
GACTACATATTGAGTTCCGGGACAGCCAGGCCTGCACAGAGAAACCCTGCCTTGAAAAAAAAANNGGCTGACACN
Sequence Type genomic DNA
Unitrap ID UNI16111

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 65532562..65533035 454
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040652 (Oaz2) NP_035082 ornithine decarboxylase antizyme 2 Gene [Source:MGI Symbol;Acc:MGI:109492]

 
Come back to gene ENSMUSG00000040652


For any suggestions or comments, please send an email to unitrap@crg.es