Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST4243-NR
Clone ID PST4243-NR
Vector U3NeoSV1
Project escells

Sequence tag PST4243-NR
Sequence
CACGAAAGGAGTCAAGATGTCACTTCTTACATATTGTGTCACCTCATGGTATCCTTCTAAGGACAGTCGGCCTTCATCTT
CTTGGTTTCCCTATGGCTCCTTTACCCACTCGGGTATTAGCACAGCCCTCCCCTCCCCATTCTCAGTCCACCAAGGTGAC
ATTGGTGACACGTCCCCCTCCCCCTACAAAGCCTATGGAATCTAATTCCCTAAACAACCTCTTCCTGTCAGGCAGACAGA
GGCTGACAGGCTGACATG
Sequence Type genomic DNA
Unitrap ID UNI15615

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 168057308..168057564 254
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000026564 (Dusp27) NM_001033344 dual specificity phosphatase 27 (putative) Gene [Source:MGI Symbol;Acc:MGI:2685055]

 
Come back to gene ENSMUSG00000026564


For any suggestions or comments, please send an email to unitrap@crg.es