Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14313F8
Clone ID IST14313F8
Vector VICTR74
Project tigm

Sequence tag IST14313F8BBF1
Sequence
GTGAGCATGCACATACAAATGTGGATAGACAANNTANTGTCCGGGAGTCAAAACTCCAGCATCACTGAAAGATAAACAGG
CAGGTGACAGGTGCACACCTATACTCGCAGCACTGAGAAAAATGAGGCTGGCGTGTGAGAGTTCCAGCGCAGCCTGAGGT
ACACTGCCACACTCTCTTAAAGATGGTTCAGCAGGCAAGGGTGCTTGCTTGATCCCTGGGGCCCCATATGGTAGGAGAGG
GCTGACTCAGACAAACTGAACACATCCATACATATACACACACAACATGCATACTGAAATGGAAATGAACAAGAAAAATA
CAAAATAGGAAGTAGGGGGAGAAAAAAAAAGCCTAAAAATACGGGTTCTGTGAGCCNTGAANACTGTAGCACATTCCTGC
AGTTTTGTACTTGGGTGAACACCGCATTACATAGGGCACACTCTTCCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5606161..5606607 437
 
EST/CDNA Est Name
  AK012461.1


Sequence tag IST14313F8HMR1
Sequence
CTCACGTGTGAGTGCAGGTGTCCGTGTATGACCGCCTTANGCCNGTCCTTGCCTTCATCTTGTTTGAAGCAGGGTCTCTT
TCTTGTCACCACCTTTGTGTGCCAGGGTAGTTGGCATACAAAGGTCTGGANACTGTCCTGCCTCTGGCTGCATCTCACGG
TGGGAGCGTGGGGGTTGCANATGCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI13766

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 5605978..5606165 180
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020477 (Mrps24) NM_026080 mitochondrial ribosomal protein S24 Gene [Source:MGI (curated);Acc:Mrps24-001]

 
Come back to gene ENSMUSG00000020477


For any suggestions or comments, please send an email to unitrap@crg.es