Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11558A8
Clone ID IST11558A8
Vector VICTR76
Project tigm

Sequence tag IST11558A8HMR1
Sequence
TTTCCTTTNCAGTATAAACCAAACCCNTGGCTGACCACTGTCCTTTTGACCTCGGAAAGCTGGGTGGTTACCAACTAAAA
GCTGATGCTTTTGTGATTTGGTGTTTGTTTTTGTATTTGTTTTTATTTGTGTTTTTTTTCCCCTTTGAANACACAGTCTC
ATGTATCCAATGCTGGCN
Sequence Type genomic DNA
Unitrap ID UNI7651

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108566131..108566307 171
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032602 (Slc25a20) NM_020520 solute carrier family 25 (mitochondrial carnitine/acylcarnitine translocase), member 20 Gene [Source:MGI Symbol;Acc:MGI:1928738]


Sequence tag IST11558A8HMF1
Sequence
NTTNCANTCGTNNATAATCCTGTNCAGAGGTCACTAGGCCCTTGCTGGGTGTAACATCAAGAGCAAGAGGAGACGAGAGA
GGAGTACACTTATATAAGGAGTCAGGATATTGCTTTTTAAAAGTCTCAGGTGTGCAGGACAAGATTTNTGCCTNTGTANA
ATAAGATTAGAAATAAAGGCCAAACAAACTCCCCCTTGCTAGACNNANCTACTTGAACCTGCCNNTGNNTNANGAGCACT
AANAATAAGAAGCACAGCCTTTGCTACTGATANGATCTGATTTCTCACAGATGAACACTACAGAGTCTCCTCGGGATGAG
CTGTCTGTGGTGAGCCTCACTTTGAACAGAGGCCGTGAGATAGCCTGCTGTCNAGCCTGCCNAGGAANANCCCTTGGATA
CTGNTCTCTTTCAGANGAAACTGGATCTGACATCCTATCAAGCCCNCNNNCNANGTTACCACCTTTATGAGATTCACATC
TTCTCTGGCTTCCNGCCCCCANCAACNCGCCATNNACACACACAAAAGACTCATGTCTTCTTCNNNCNNGNNNNTCCTGG
CTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032602


For any suggestions or comments, please send an email to unitrap@crg.es