Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12296H2
Clone ID IST12296H2
Vector VICTR76
Project tigm

Sequence tag IST12296H2HMF1
Sequence
GGGAAAGAAGGAAAGGGAAAGGGGAAGAGAAAGAGAAAAGAAAGCGATCACGTTTTGAGCTTGTATTTAGGAGTTCCCTC
CCAGGCCCCGGCTCAATCAGGGAGGACCCCAGCCAGGCTGAGCCGGACCTCTGCTCCTCTCAGAGCCCCCCAGGCATCAT
GAGCGTGCTAGATGATGTGTGTGCCACGATGCATGCTACCGGTGGCGGCGCGGACCAGACACTGCTACAAAAGCTGCAAG
CGGCAGTGGGCACCCACGAGCACTTCAACAGCTGGAGCGCGGGTTTCGTCATCCATCACTATGCAGGCAAGGTGCGTGGA
ACTCCCTTCTAAGTGGGCGCCCCCTCACAAATCCCTGTCCAGTTTGCAAACTTCCTACTCCTCTGACCAAATTCCTCTTC
CAGANGGGCCCCAGCTAGGATTGTCCCAGTGGCCCAAAGGTCTTCCGAAATCGCCTANACACCTGCCTCATGTCCCCTCT
GCCNGANCTACAGACACACACTGGNCCTCTAATCNCAGTTTACCTAATTAGCANNGCANCTCCTAACAGAN
Sequence Type genomic DNA
Unitrap ID UNI30925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33722918..33723466 530
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]


Sequence tag IST12296H2BBF1
Sequence
GGGAAAGAAGGAAAGGGAAAGGGGAAGAGAAAGAGAAAAGAAAGCGATCACGTTTTGAGCTTGTATTTAGGAGTTCCCTC
CCAGGCCCCGGCTCAATCAGGGAGGACCCCAGCCAGGCTGAGCCGGACCTCTGCTCCTCTCAGAGCCCCCCAGGCATCAT
GAGCGTGCTAGATGATGTGTGTGCCACGATGCATGCTACCGGTGGCGGCGCGGACCAGACACTGCTACAAAAGCTGCAAG
CGGCAGTGGGCACCCACGAGCACTTCAACAGCTGGAGCGCGGGTTTCGTCATCCATCACTATGCAGGCAAGGTGCGTGGA
ACTCCCTTCTAAGTGGGCGCCCCCTCACAAATCCCTGTCCAGTTTGCAAACTTCCTACTCCTCTGACCAAATTCCTCTTC
CAGANGGGCCCCAGCTAGGNNTGTCCCAGTGGCCCAAAGGTCTTCCGAAATCGCCTANACACCTGCCTCATGTCCCCTCT
GCCNGANCTACAGACACACACTGGCCTCTAATCACAGTTTANCTAATTAGCANGGCAGCTCCTAACAGAN
Sequence Type genomic DNA
Unitrap ID UNI30925

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 33722918..33723466 533
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024300 (Myo1f) NM_053214 myosin IF Gene [Source:MGI Symbol;Acc:MGI:107711]

 
Come back to gene ENSMUSG00000024300


For any suggestions or comments, please send an email to unitrap@crg.es