Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14904G4
Clone ID IST14904G4
Vector VICTR76
Project tigm

Sequence tag IST14904G4BBF1
Sequence
ATTTGATCTCCCGATCTGCCTGCCTCCACCTTTCCAAGTGCTGCTATTATAGTTGTGTGACAGCACTCTTAGCTGTCAGC
AGTCTCTTATCACTCACTCACTCAGCCACTATTCATGAAGAACTGAGATGTTCTTGGCGCTCAGGTAGATGCTGAAGGTA
CAGGCTGGAGAGGCGCTGCCTGACCAGGATTAGCTCCTTGGCAAAAAATCCAACTATTATCATCTGATCCAATCGTACAC
AGGGCATGTCCACAGGCCTGGGGTCCCTCTGTCTCTATCCACGCCCCTCCTTCCCCACAGAATCTCATCTCCCTCACTCC
AGTTCCACTGTGCTCCCCAGATCTGAGTCCTCACCTCTAGTAGTCATGATGAGGGTGTTGTCTTCTCGCCCGTATCGGCC
AAAGCACAGGCTGGTTACNGCATCCTGCGGGGGANCCANACTTTANCTGGGAAAAGANCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4894608..4895064 449
 
EST/CDNA Est Name
  AK163815.1


Sequence tag IST14904G4HMF1
Sequence
ATTTGATCTCCCGATCTGCCTGCCTCCACCTTTCCAAGTGCTGCTATTATAGTTGTGTGACAGCACTCTTAGCTGTCAGC
AGTCTCTTATCACTCACTCACTCAGCCACTATTCATGAAGAACTGAGATGTTCTTGGCGCTCAGGTAGATGCTGAAGGTA
CAGGCTGGAGAGGCGCTGCCTGACCAGGATTAGCTCCTTGGCAAAAAATCCAACTATTATCATCTGATCCAATCGTACAC
AGGGCATGTCCACAGGCCTGGGGTCCCTCTGTCTCTATCCACGCCCCTCCTTCCCCACANAATCTCATCTCCCTCACTCC
ANTTCCNCTGTGCTCCCNANATCNNANTCCTCACCTCNNNTANTCNTGANGANGGTGTTGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4894608..4894989 352
 
EST/CDNA Est Name
  AK163815.1


Sequence tag IST14904G4HMR1
Sequence
CAAATCTATCCTAAGCTATATGGATCCTGTCTTCAGGAGGAAAAAACAGGCAGACTTGAGATATTTCATGTCTTCTAGAA
AGTGAGTCTCTTCAGAAGGACCGACATGCTTGGACAAGAGTGCCGTTGTTTGGGGAAGAATGGNAANGNGNNGNNNGNCN
GGGN
Sequence Type genomic DNA
Unitrap ID UNI35369

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 4894467..4894612 144
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000006464 (Bbs1) NM_001033128 Bardet-Biedl syndrome 1 (human) Gene [Source:MGI Symbol;Acc:MGI:1277215]

 
Come back to gene ENSMUSG00000006464


For any suggestions or comments, please send an email to unitrap@crg.es