Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13328E7
Clone ID IST13328E7
Vector VICTR74
Project tigm

Sequence tag IST13328E7HMF1
Sequence
AGACCAGGCTGGCCTCGAACTCAGAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATTACAGGTGTGTGCCACCACTG
CCCAGCATCATACTTTTCAAACTTACCTGTCATAAGTTTATGGACATCTCTGTTGGACCATCACTCACCAGGACTAGCTT
GAACAAGACCTGAGCAACCGTCTTGACAATCCTTCCAGAAAAGTCTCCATACCCATCTGACTAAGCATAATTTTTCCTTC
CTTCCTCCCTCCCTCCCTTCCTTCTCGTTCTTCTCTTCCTCTTCCTCCTTCTCCTTTCTCTCTCTCTCTCCTTTTCTTTT
CTTTCTTTCTTTCTTNCTTTCTTTCTTTTTTTTTTTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 106882537..106882892 354
 
EST/CDNA Est Name
  BE380789.1


Sequence tag IST13328E7BBF1
Sequence
AGACCNGGCTGGCCTCNAACTCAAAAATCCGCCTGCCTCTGCCTCCCAAGTGCTGGGATTAC
Sequence Type genomic DNA
Unitrap ID UNI6169 UNI17357 UNI31398 UNI35370 UNI35371

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 57139901..57139961 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 24325396..24325456 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 48240102..48240162 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 92869623..92869683 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 101580910..101580970 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000021629 (Slc30a5) NM_022885 solute carrier family 30 (zinc transporter), member 5 Gene [Source:MGI Symbol;Acc:MGI:1916298]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 60163910..60163970 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 61596345..61596405 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 67454818..67454878 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 108658528..108658588 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 93676757..93676817 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020022 (Ndufa12) NM_025551 NADH dehydrogenase (ubiquinone) 1 alpha subcomplex, 12 Gene [Source:MGI (curated);Acc:Ndufa12-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 72337127..72337187 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036246 (Gmip) NM_198101 Gem-interacting protein Gene [Source:MGI Symbol;Acc:MGI:1926066]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 40117710..40117770 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000057716 (EG434008) NM_001004182 predicted gene, EG434008 Gene [Source:MGI Symbol;Acc:MGI:3647581]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 87267015..87267075 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 29969085..29969145 57
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039000 (Ube3c) NM_133907 ubiquitin protein ligase E3C Gene [Source:MGI Symbol;Acc:MGI:2140998]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 33337250..33337310 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 95391139..95391199 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 70900152..70900212 57
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 79203093..79203153 57
NO GENE  

 
Come back to gene ENSMUSG00000039000


For any suggestions or comments, please send an email to unitrap@crg.es