Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12507G7
Clone ID IST12507G7
Vector VICTR76
Project tigm

Sequence tag IST12507G7BBF1
Sequence
AACCGGAGGTTGCTGAGGACGATCCATCCTTCCTGAGAAGCAGAACCTGACTGTGGCAGATCCGCTGAGTCACAGCGTCG
GTGTCCGAGCTGAACCCGGGTCTGGCGTCTGGCGCCCCCTAGCGAGGCCTGAGTGGCAGAAAACCCCACTCGGCGCTGCC
CGGAGCACCGCGGGCCCCCCACCCCACCCCTCGCACCCAGGAAGCTGCTGGGTCCAGGTCTCACAGGCGTCTGAATCACA
AACCTCAGACCAGCCTCACTCCGCCCTTTTACGGGGGAATGAAGGCTTGTGGGAAATGAAGCGAGCGATGTGGGACAGTC
GCTTANAAATGGGTTTTAGTGGCAAAAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI30181

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104139639..104139991 351
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es