Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12342D8
Clone ID IST12342D8
Vector VICTR76
Project tigm

Sequence tag IST12342D8HMF1
Sequence
NNNNCNNCTTATGATGCGAGTTGNNATANACCTCTNAACATCANAGGANCANAACATNTNANNNNNCNATGACCCTGTTC
TAAACATGAATTAATTTNNTANAACTGTGCCNANCTNGCCTANGCATACAGCTTCTGTTTTCTTANTNTNNGCCTGGTAC
ATANCCCANGANCCNCTANCCATTTACATCNNACAGGAAGATGGCGGGCAGGGGGTGTCCTAAAACCAATCATTTTATCT
TATCTCCTACTGTGCCCNTTCCTACTACCCTTGTTCCTTCCTCATCTAANCTTCTTCCACTNTNNNCCCCCACTTCTCCA
NANAGCANCTNACTTTTGCAAGTCTGATTTGAACCTGACCTGTGCANGGGTGGTTCTCACATCTCTGGCTTTTCCCANNA
CAGCATCTCTCTGTCCCCAGCTCTCTGGTGCTNCATCTNATCCTCCCGTGGTCNTTCCNNCCCTGCNTTTANTCACTTGC
TCTCNNNNNNNCTTNNTGCTNNNNCGGGTCCACGTTTCTGANTGCCTTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST12342D8BBF1
Sequence
ACAACAGCTTCTGATGCGAGTTGTCATAGACCTCTAAACATCAGAGGAACAGAACATCTCAGCCTCCAGTGACCCTGTTC
TAAACATGAATTAATTTAATAGAACTGTGCCTAGCTAGCCTAGGCATACAGCTTCTGTTTTCTTAATATCTGCCTGGTAC
ATAGCCCAGGAACCACTAACCATTTACAGCAAACAGGAAGATGGCGGGCAGGGGGTGTCCTAAAACCAATCATTTTATCT
TATCTCCTACTGTGCCCCTTCCTACTACCCTTGTTCCTTCCTCATCTAAACTTCTTCCACTCTAAGCCCCCACTTCTCCA
GAGAGCAGCTCACTTTTGCAAGTCTGATTTGAACCTGACCTGTGCAGGGGTGGTTCTCACATCTCTGGCTTTTCCCAAGA
CAGCATCTCTCTGTCCCCAGCTCTCTGGTGCTCCATCTTATCCTCCCGTGGTCATTCCCACCCTGCCTTTAGTCNCTTGC
TCTCCTTTTCCCTTCATGCTCNACCGGGTCCACGTTTCTNANTGCCTTGTAGATTANNNTGTTNNGGTTTTTTTTTTGGG
GGGGGGG
Sequence Type genomic DNA
Unitrap ID UNI29712

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40205968..40206534 547
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000040111 (Gramd1b) NM_172768 GRAM domain containing 1B Gene [Source:MGI (curated);Acc:Gramd1b-002]

 
Come back to gene ENSMUSG00000040111


For any suggestions or comments, please send an email to unitrap@crg.es