Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11562B10
Clone ID IST11562B10
Vector VICTR76
Project tigm

Sequence tag IST11562B10HMR1
Sequence
CTATATAGGGCCCCAGAGGTGATCACCATTTTGGGGGGTATCTGAGATTTGTAACGTGGCAG
Sequence Type genomic DNA
Unitrap ID UNI1985

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 22410767..22410828 62
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000013089 (Etv5) NM_023794 ets variant gene 5 Gene [Source:MGI Symbol;Acc:MGI:1096867]

 
Come back to gene ENSMUSG00000013089


For any suggestions or comments, please send an email to unitrap@crg.es