Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14178B12
Clone ID IST14178B12
Vector VICTR74
Project tigm

Sequence tag IST14178B12HMF1
Sequence
CTAGGGTGCAAGCAGTCCCCGTGGCATGCTTCTGTGTANTTTCTGCTGCGTTGGCCTTTGTGTCTGTGCCACGATGTANC
TAATAAACTCTGCCACTTTTTTTTTGTGTTGCCAAACTCTTTCACNGNANTAACCTGCTTATTGCCNTCNTCACTGCCAA
TCACCCCGCTANTCANCATTTCCTGANTTCCAGGAGGACTNANNANNCCNTGTTCNGGAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14178B12HMR1
Sequence
CTAGGCTTGGGAATTATTCNGACAGTCAGGTGTTCCATTCTCACTGAGCCTGGGAACAGTCGCAGTTGCAGCTTCCTTGG
TTAGTGACAGTCTAGCCTTGAGGAAATGGTGATCTTTCCCCGAGTCAGAAGTGGACTGGCACAGCCGTGTGTCTTAAACA
GACACACN
Sequence Type genomic DNA
Unitrap ID UNI14237

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 104162705..104162871 165
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018411 (Mapt) NM_001038609 microtubule-associated protein tau Gene [Source:MGI (curated);Acc:Mapt-003]

 
Come back to gene ENSMUSG00000018411


For any suggestions or comments, please send an email to unitrap@crg.es