Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14168C9
Clone ID IST14168C9
Vector VICTR74
Project tigm

Sequence tag IST14168C9HMF1
Sequence
TAAGNNNATAGCCGGGCGTGGTGGCACATGCCTTTAATCCCAGCACTCGGGAGGCANAGGCAGGCGGANATCTGAGTTCA
AGGCCAGCCTGGTCTACAAAGTGAGTTCCAGGACTGCCANANCTATACAGANAAACCCTGTCTCAAAAAANANNCNAANN
CAAANNANCCNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14168C9HMR1
Sequence
ATTTTTATTGCTACTTCACAACTGTAACTTTGCTACTGTTATGAATCATAATATAAATATATCATGTGCAGGATATCAGA
TATGCAGGATATCTGACATGTTACCCCTGTGAAAGGGTCATTTGACCCTCAAAGGGGCTGANACCCACAGGTTGAGAAAC
ACTGCTCTAAGGCGTATATTAAGCAACTGCCTCANAATGAAGGTGCTAGTGATATTCAAGAATGTGCTTTAGATTGTTAT
TATCATCATGGTGCGTGGGATCAAACTCGGAGCCTTGTGCATGCTACACAAACACTCTACTACAAGCTGGACACCCANCC
AACANGCACCCCCTTCTGTGGGTGTTTTCAGTAACTGGATTTCAAGCATAANCACATACAAGGGCAACGCANGCAATAAG
GGCAACAGTTACAGANCATCTGGGTCTCACACTGNGTGGTGAATCTGCTGGGCNAACANTTCNTGNGTN
Sequence Type genomic DNA
Unitrap ID UNI32135

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71610117..71610584 444
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032232 (Cgnl1) NM_026599 cingulin-like 1 Gene [Source:MGI (curated);Acc:Cgnl1-003]

 
Come back to gene ENSMUSG00000032232


For any suggestions or comments, please send an email to unitrap@crg.es