Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14793C11
Clone ID IST14793C11
Vector VICTR76
Project tigm

Sequence tag IST14793C11BBF1
Sequence
NTGGTTTGGGGCAAAAANATNAGGGCCTCTACNGNNNNGACTCANAAGTACAAAATTTTCANGGACTTAATGTGGTTTAA
AGTGAATTCTTACCTNAGTTTTNANTATGTGCTCAAATTTGGACCCCCTAAAAAAGCANGAAAATGANAAGGAACTGGGT
GTGTTGGCACACACCTGAGTCTCANTGCTTGGGAGGACAGGCAGAAAAATTCAAGGCCATCCTTGGCTATAGAGAGTTTG
AGGCCNGTCTGGATTGNNTGAGACCTTGTTTATGTGTGGGATGGGGANAGGCTGGCANANAAANATGGGAAGAGAGAGAG
GANANAATGCTTTANGGAANTGCTCAATATTTTANTTTGCTTTGGGTTTTTGTTTTNANANAGGGTCTGACTTTGTANCC
NTGGCNNGNNNNNNACTCACAGAGCTNTGCCCNATAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14793C11HMF1
Sequence
GTGGTTTGGGGCAAAAAGATCAGGGCCTCTACAGTCAGGACTCAGAAGTACAAAATTTTCAGGGACTTAATGTGGTTTAA
AGTGAATTCTTACCTCAGTTTTCAATATGTGCTCAAATTTGGACCCCCCAAAAAAGCAGGAAAATGAGAAGGAACTGGGT
GTGTTGGCACACACCTGAGTCTCAGTGCTTGGGAGGACAGGCAGAAAAATTCAAGGCCATCCTTGGCTATAGAGAGTTTG
AGGCCAGTCTGGATTGTATGAGACCTTGTTTATGTGTGGGATGGGGAGAGGCTGGCANANAAAGANGGNAAA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13989016..13989326 303
 
EST/CDNA Est Name
  CV306102.1


Sequence tag IST14793C11HMR1
Sequence
CCACCATGATTGAGACTTGCTTCTTGTTTCAGTGCCNGATCAGTTTCTTATGTGCCTTGGCACAGATCTCCAAACCAACC
CCCAGCTCTTTAAGCTATTCACATTTGAAATCCCAAAGCAGGAATCCAGGGACCCACTTTAGATACTTGACTCTGGCAAG
TTTTGGCATTTTAATTCCTGTCTCTAATCAAGCATTTTGGGATTTTTGTTTATATGTAAACATCCTCTCAATTCACAAGG
GATTCATAGAGCTATCCAACAGGTCTGANCCTCTATTCATTTATTAATTAAGTCTANAAATTAGTAATACTGGGGCTATG
GCCN
Sequence Type genomic DNA
Unitrap ID UNI14552

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 13989323..13989645 317
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044117 (2900011O08Rik) NM_144518 RIKEN cDNA 2900011O08 gene Gene [Source:MGI Symbol;Acc:MGI:1914504]

 
Come back to gene ENSMUSG00000044117


For any suggestions or comments, please send an email to unitrap@crg.es