Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15056B12
Clone ID IST15056B12
Vector VICTR80
Project tigm

Sequence tag IST15056B12HMF1
Sequence
CATCTACCTACCAGCTTATTTTATGTCTGCTTCTATTTGGACACCACATAGAACAGATACTGTTGATTTTGGAGATTCTG
GTGGCCCAGGGCAATCCCAGCACGTGGGAAGTGGCAATGGGAAAAGTTCTAGGCCAGCATGGAGCCACAGGAGAACTCTG
CCTCACAAACAAACAAATCACTTCTAAACAGAAAAATTCAAACAAACAAAATCTAACTCCCAGCCAAGCAACTACAATTC
ACACTCTAAAGCTGCTCAAAGCGGCTTTTATGTAGCACGTTATGGTGCATCAGTCTCTCTCACTCATCCTGTAGCTAACT
CATTCAGCCNGGCTGCCTANCTATCAAACTGAAGATGGGTCTGTTCACCCTCATCCCAGTTCTGGGGCTAGAGATGTGTA
TCTCTGANCCCCCGATTTTAAGTGANGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84847672..84848098 416
NO GENE  


Sequence tag IST15056B12HMR1
Sequence
GATGAAACTGTGACCNGAGGCTTATTGGAACCTTGTCTGCACTTCCCTACAACAGGGGCTGGAAGTTTGCTACTTTGGTA
CCTGCAGTCCCTTAGTAGAGAGTGACTTGCCACGAGCCATGAGATCATGCTGACCAAGCACATGCTTCTCAGGGGGAGCT
CACGCTCAGCTCTATTGCTGAGGTCATTGGCCCCGTCTGGTCCACCTCCCACTGAGAACTGGGCTAATAGTCGGCACTGA
AAGGTTTCCAACCAAACCTTATTTTCTTGTCCTGTCCAAAATTCATTCCACTCACTACTGCCCTTTCCAGCTCCTGTCTA
CCTACACACCACTAGGATAACAGTGGAAAGAGTCATTANGAAAGAATAAGCACGTGACCCAAGGCCTCACACAAACTGCA
TTGTTAGTTCANCCTGAACNNAGANANTCC
Sequence Type genomic DNA
Unitrap ID UNI13061

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84848095..84848523 415
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073633 (Fbxo36) NM_025386 F-box protein 36 Gene [Source:MGI (curated);Acc:Fbxo36-001]


Sequence tag IST15056B12BBF1
Sequence
CATCTACCTACCAGCTTATTTTATGTCTGCTTCTATTTGGACACCACATAGAACAGATACTGTTGATTTTGGAGATTCTG
GTGGCCCAGGGCAATCCCAGCACGTGGGAAGTGGCAATGGGAAAAGTTCTAGGCCAGCATGGAGCCACAGGAGAACTCTG
CCTCACAAACAAACAAATCACTTCTAAACAGAAAAATTCAAACAAACAAAATCTAACTCCCAGCCAAGCAACTACAATTC
ACACTCTAAAGCTGCTCAAAGCGGCTTTTATGTAGCACGTTATGGTGCATCAGTCTCTCTCACTCATCCTGTAGCTAACT
CATTCAGCCNGGCTGCCTAGCTATCAAACTGAAGATGGGTCTGTTCACCCTCATCCCAGTTCTGGGGCTAGAGATGTGTA
TCTCTGANCCCCGATTTTAAGTGAGGATACAAACTCAGGCTCTCACTTGTACAGCAAGTCCTTTACCCANTANCCATTGT
CTNANTTCCTGGTCTTTGTTTTGNTTTATCCNNANACAGTCTCTCTGTGCANCCCTTGGCTGNCCTGNGNNNAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 84847553..84848098 519
NO GENE  

 
Come back to gene ENSMUSG00000073633


For any suggestions or comments, please send an email to unitrap@crg.es