Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15078E3
Clone ID IST15078E3
Vector VICTR80
Project tigm

Sequence tag IST15078E3HMR1
Sequence
ATGTTGAGTATGAATATAATTAATGTCNCAGAGTTGTACTTAAAAGTGACCCTATATATTTTTGAAAAGCACAATTAAAA
AAATAAGTTCAGTGTTAGCATCCGTGCCTGGGGAAAGCTCGGCTCTTTCAGGAGCCCCCGGGATGGATTGTGACACAGGA
GATACACAGGCTCAGCCCAGGGTCTGAGCCCTGCTCTTGTCTCTGATACAGATTTCCAGCAAGGCACTGAGT
Sequence Type genomic DNA
Unitrap ID UNI29636

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57296878..57297109 230
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038764 (Ptpn3) NP_035337 protein tyrosine phosphatase, non-receptor type 3 Gene [Source:MGI (curated);Acc:Ptpn3-001]


Sequence tag IST15078E3HMF1
Sequence
CATTGTGCAACTATTACCACTATTTCCAGAAAATTCCCTCACTCCAAACAGAAACTCTGTACCCATTAAGCAATACGCAC
CTACCCAATTCCAAGCAATCTCTCTACCGTCTTCTGTCTCTGTGGGTTTACCCAGTTTTGATCTTTCATGTGAGTATGCA
GGTGTGTCCTGGTTTGCTTTCTATTGTGATAAAACTAAAAACCAAAAACCAAAAACCAAACAGGGGAGGCAGAGGCAGGA
GGATTTCTGAGTTCAAGGCTAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGGCTACACAGAGAANCCAAAAACN
NAAACCAANCNNACAAACAAANNAAACACAACCNAAATCAACTTGGGGAGAAAAGCACTTATTANGCCTACAGANCANAN
TCACTCCAAGGGAAGTCNAGNCNNGGTGTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57297107..57297537 397
 
EST/CDNA Est Name
  BB662384.1 - BY351393.1 - BY351531.1 - BB871784.1 - BY350486.1 - BY352327.1 - BY349020.1 - BB869375.1 - CJ129901.1 - BY352340.1 - BY347642.1 - BB873140.1 - BY773772.1 - BY134918.1


Sequence tag IST15078E3BBF1
Sequence
CATTGTGCAACTATTACCACTATTTCCAGAAAATTCCCTCACTCCAAACAGAAACTCTGTACCCATTAAGCAATACGCAC
CTACCCAATTCCAAGCAATCTCTCTACCGTCTTCTGTCTCTGTGGGTTTACCCAGTTTTGATCTTTCATGTGAGTATGCA
GGTGTGTCCTGGTTTGCTTTCTATTGTGATAAAACTAAAAACCAAAAACCAAAAACCAAACAGGGGAGGCAGAGGCAGGA
GGATTTCTGAGTTCAAGGCTAGCCTGGTCTACAGAGTGAGTTCCAGGACAGCCAGGGGCTACACAGAGAAGCCAAAAACC
AAAACCAACNNAACAAACAAACAAAACACAACCNAAATCAACTTGGGGAGAAAAGCACTTATTANGCCTACAGATCACAG
TCNCTCCNAGGGAAGTCGAGGCNNGGTGTGANGCAGANCNTGAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 57297107..57297549 421
 
EST/CDNA Est Name
  CJ066835.1 - BB662384.1 - BY351393.1 - BY351531.1 - BB871784.1 - BY350486.1 - BY352327.1 - BY349020.1 - BB869375.1 - CJ129901.1 - BY352340.1 - BY347642.1 - BB873140.1 - BY773772.1 - BY134918.1

 
Come back to gene CJ066835.1 - BB662384.1 - BY351393.1 - BY351531.1 - BB871784.1 - BY350486.1 - BY352327.1 - BY349020.1 - BB869375.1 - CJ129901.1 - BY352340.1 - BY347642.1 - BB873140.1 - BY773772.1 - BY134918.1


For any suggestions or comments, please send an email to unitrap@crg.es