Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone GC0311
Clone ID GC0311
Cell line E14Tg2A.4
Vector pFLIP1
Project tigem
Note NULL

Sequence tag GC0311
Sequence
GGTGCACTCACTCTCTGAACTGTCTGTATGCTCGAGATCTGTAGAAAAATCGGAATCTTCGGTTCCATCTGAACTACTGC
CTGCATTTCTCTTCCTTCGCGGCATTCC
Sequence Type mRNA
Unitrap ID UNI22

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 95167421..95171364 88
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038909 (Myst2) NM_177619 MYST histone acetyltransferase 2 Gene [Source:MGI (curated);Acc:Myst2-002]

 
Come back to gene ENSMUSG00000038909


For any suggestions or comments, please send an email to unitrap@crg.es