Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST11632B6
Clone ID IST11632B6
Vector VICTR76
Project tigm

Sequence tag IST11632B6HMR1
Sequence
CCAAACTGTGTCTCTGTAACTCCTTCCATGGGTGTTTTGTTCCCAATTCTAAGAAGGGGCAAAGTGTCCACACTTTGGTC
TTAATGACCATACAATATGTATGATTTTGTATATGTCTTCATAATGATGCTAACTTTCTCTAAGAGAAATTTAAATTTTG
TTTTATAGTGAAATATANTANATATACTCCTAACANATTAAAACNNANTTAATTTCNTATGCTGCTAANATTAACTTACT
TTCCCTTCTTTCTTACTTCTGGTGTACNTTTACAATCCTTTGGGGAATTTTTTTN
Sequence Type genomic DNA
Unitrap ID UNI13708

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 71733872..71734165 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032228 (Tcf12) NM_011544 transcription factor 12 Gene [Source:MGI Symbol;Acc:MGI:101877]

 
Come back to gene ENSMUSG00000032228


For any suggestions or comments, please send an email to unitrap@crg.es