Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5175-NL
Clone ID PST5175-NL
Vector U3NeoSV1
Project escells

Sequence tag PST5175-NL
Sequence
CAGGAGTATCAGCACTCATCAGTGAGTTGAGTGGTGGGTGGGAAGCCCGTTTTGGGGGGATGGGGGAGCGGTGTCAGAGT
ATTTGAATGTTTTGAGGGTTTTAAGGTGTAGTATGTTTGCTTTTCCCATTTTTACCTAGGATGCATCACCAAGAGTCCCT
GGAGGCTCCCCTCGAACACCAAACAGATCTGTGTCATCCAATGTTGCCAGTGTGTCCCCCATCCCTGCTGGATCCAAAAA
AATTGATCCAAACATGAAAGGTA
Sequence Type genomic DNA
Unitrap ID UNI10042

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 114629529..114629790 259
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032435 (Dync1li1) NM_146229 dynein cytoplasmic 1 light intermediate chain 1 Gene [Source:MGI Symbol;Acc:MGI:2135610]

 
Come back to gene ENSMUSG00000032435


For any suggestions or comments, please send an email to unitrap@crg.es