Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14783B10
Clone ID IST14783B10
Vector VICTR76
Project tigm

Sequence tag IST14783B10HMF1
Sequence
GCGACCGCTGCTGCTGTGGCTTAGGTCGCCTCCCCAGCCGGGCGGGCACCTGTCCTCTGGTCCGGAAGGTGGCCGGCTGT
CCCCGGCCCACACAGGGTGCTGCCTCAGCGCCTCTGTGCTTCTGCCTGTTCCAGAAGCTGTCAGGTTCTCTGGCGCGCCC
TCTCACCTGTTCAGACTAATTTCCTAAGTTCGGCGGGTCCCGGACCAANATGGCNACCGCTGCTGCTGTGGCTTANGCCG
CCTCCNNAACCNGGTGGGCACCTGTCNTCNGGTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 25939572..25939845 256
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 79438439..79438712 256
NO GENE  


Sequence tag IST14783B10HMR1
Sequence
GTCNCCATCTTGGTCCCAGGACTCCAAGGAACTTAGGAATTTAGTCTGCTTAGGTGAGAGTCTGTACCACCTGGGAACTG
CCAAAGCAACACAGTGTCTGANAAAGGTCCTGTTTTGGGCCTTCTTCTTCGGCCAGGANGAGGTCCAAATACAAGATATC
TGCGCACCTTCCCTGTAAGAGAGCTTGCCAGCAGAGAGTGCTCTGANCACTGAAACTCANAGGAGAGAATCTGTCTCCCA
GGTCTGCTGATAGACGGTAACAGAATCACCAGAAGAACANTCTCTAAACNNANTCC
Sequence Type genomic DNA
Unitrap ID UNI33690 UNI35379

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 48984376..48984664 277
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 38801674..38801962 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036095 (Dgkb) NM_178681 diacylglycerol kinase, beta Gene [Source:MGI Symbol;Acc:MGI:2442474]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 4313500..4313788 277
 
EST/CDNA Est Name
  AW209547.1 - AI595125.1 - AI595533.1 - AL360872.1 - BQ552738.1 - BY297169.1 - CA464211.1 - BU743854.1 - BB679775.1 - BY093521.1 - AW210429.1 - CA530764.1 - BU782242.1 - BU788456.1 - AA656026.1 - AI644954.1 - BY080252.1 - BF149456.1 - BB679700.1 - AI225838
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 25939841..25940129 277
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 97086008..97086296 277
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 79438708..79438996 277
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 79607499..79607787 277
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 95418509..95418797 277
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046532 (Ar) NM_013476 cytochrome P450, family 19, subfamily a, polypeptide 1 Gene [Source:MGI (curated);Acc:Ar-001]

 
Come back to gene ENSMUSG00000046532


For any suggestions or comments, please send an email to unitrap@crg.es