Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15083G7
Clone ID IST15083G7
Vector VICTR80
Project tigm

Sequence tag IST15083G7BBF1
Sequence
ATCCAGATAAGGATCTCCAAGCCTCCAGATAAGGGTCACTGGTGAGCCTTCCAATTCCGAATTGTAGTTCATTCCAAATA
TTGTCAAGTTGACAACCAGGAATAGCCACTACAGTTAGTTTTTTTGGTTTTATGTAAGATGTATTTACTTATTTTATGTA
TATGAGTACACTGTAAATGTACAGAAGGTTGCGAGCCATCATGTGGTTGCTGGGAATTGAATTTTAGGACCTCTGCTCAC
TCCGGCCCAAAGATTTTATTATAAATAAGTACACTGTAGCTGTCTTCAGAAGCACCAGGAGCCATCATGTGTTTGCTGAG
AATTGAACTCAGGACCTCCAGAANANAAGTCNGTGCTCTTAACCAACCGCTGAGCCAGCTCTCCAGCNNNNNNTTGGTTT
TCAAGANAGGGTTTCTGTCTGTATCCTTGTNTGTCCNGNAACTNNNNNCTGGCCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 84965596..84966050 419
NO GENE  


Sequence tag IST15083G7HMF2
Sequence
ATCCAGATAAGGATCTCCAAGCCTCCAGATAAGGGTCACTGGTGAGCCTTCCAATTCCGAATTGTAGTTCATTCCAAATA
TTGTCAAGTTA
Sequence Type genomic DNA
Unitrap ID UNI30946 UNI31095

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 53993090..53993179 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 36657655..36657744 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 31819230..31819319 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000022770 (Dlg1) NM_007862 discs, large homolog 1 (Drosophila) Gene [Source:MGI (curated);Acc:Dlg1-002]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 16878919..16879008 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 62186133..62186222 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 45777737..45777826 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 22295805..22295894 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 14224146..14224235 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 14976494..14976583 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 104432761..104432850 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 45000166..45000255 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 85821324..85821413 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 70518241..70518330 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 69759916..69760005 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 39594884..39594973 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 35325253..35325342 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 3269999..3270088 90
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 19960574..19960663 90
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036617 (Etl4) NM_001081006 enhancer trap locus 4 Gene [Source:MGI (curated);Acc:Etl4-007]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 90726683..90726772 90
NO GENE  


Sequence tag IST15083G7HMR1
Sequence
NCCCATTTANGACTGAGGGCTCTAAGGTTTCTCTGCTCACTGTCTNATCTACTGCANNAANATACTTCCATGTTTAAGGC
NCTGATCTTANTCCCAGCCTANTGTGGTCATTGAGGTCACCGCAGTACAAAGTGTTTCTGTGGGAGATCCATTGACACAA
AGGAAGAGAGATGGGCTGGGAGGAAAGGTTGAAAGAAAGGGTGGGAAAGAACTAGGGGATCATGGGTCTGCACCAAGGGG
CTGAATCCCCAGGGAACGGAGGTGAGGTCATGAGTCGATTTCCNAAAGTCCNNCTGCNCTGTANGATANCNNNNGTATGT
GAGTCANAAGGGACAGCTGGANTNNGAATATTCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000036617


For any suggestions or comments, please send an email to unitrap@crg.es