Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14963D12
Clone ID IST14963D12
Vector VICTR76
Project tigm

Sequence tag IST14963D12BBF1
Sequence
NACTCACCGTGTGAACCTCCAGCTTGACCCCTAGGCATGCTGGGATCT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 134865333..134865378 46
NO GENE  


Sequence tag IST14963D12HMF2
Sequence
GTTAAAGCTCTTGAAAGCATGGATGTGCGGGACGTGATGATAGAGCTATAGTCCTTTGGGTCTGGCTGAAAGTGAGGTGG
TATGTGCTTAAACCCAAAGGCCAGTGGAGCTTAAACCAGGAAGGACCTGGGTGTGCTCTGGGAAATCACCAGCGTTGTTT
ACAATAGGGAAGTGGATACAATAGGGACAGTTACAAGGGAATCCTGGAAAAGCATTGGAATACAGGAGTCAGACAAGANA
AACTGCACTCAGAAAAAAAGTTAGAAATTGCGGTAGANGAAGCAGAGTCNGGAAAGANGAGTTGGGTGGGGTANTCNACG
Sequence Type genomic DNA
Unitrap ID UNI35385

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 13: 99872072..99872390 307
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000074744 (Gm807) gene model 807, (NCBI) Gene [Source:MGI Symbol;Acc:MGI:2685653]


Sequence tag IST14963D12HMR1
Sequence
AGTCCNAGGTNANATGANACTGCTCTGANNNNTAGGGACCCTGANCAATGACCNNGGAAGGACAAAGGCACACTGAGGGG
CTGAGGACAAGCCANCTGGCAGGCCAGGCCANCTTGCAACCCGANCCCATTGCCACCCAACCACCCAGGCTCTCCGGTTC
CCGGTCTCCTTCCCAGCCCCTGTCCANGANTCTGAGGTANAGATGCNNGCTTGACAGACNAGGAGTGCTCACAGCCTAAT
ACACNNNAGACACTTCTACTCANANGCACCTCCNNAANTTTGANACAAAGTGTCTTGTTTTGGANACAGGGAAACTGANG
CCGGTTGTGCACTTTCTGCNGCNCTTTCTGTTCNCCTGACNNNNNTCCANGGCCCANGACAAGGCTTANCNCCCGCCGGC
TCTCAACGCACANNGNCANNNTGGCTGANTGAATGACTGNNANGCATGTTTCTGANTACCTANCACACAGGANAAGCAGG
CTCNNNTGACAGCCNACTGTCNNANCCCAGCTCATTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000074744


For any suggestions or comments, please send an email to unitrap@crg.es