Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST12265H5
Clone ID IST12265H5
Vector VICTR76
Project tigm

Sequence tag IST12265H5BBF1
Sequence
GGGTGGGGTCTAAGGAGAGAGTGGGCCACCGCCCTGAGGGCTGTTTATCCAAAGCCAAGAGTCCGCGACAGGTGCCGCAC
CCCAGATCTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 129105579..129105667 89
NO GENE  


Sequence tag IST12265H5HMF2
Sequence
ATTATTTTTTGGATTTCCTCAATTTCTGTTGTTATATGTCCCTTTTCATTTCTGATTTTGTTCATTTGGATACTGTCTCT
GTGCCCTCTGATTAGTCTGGCTAAGGGTTTGTCTATCTTACTGATTTTCTCAAAGAACCAGCTCCTGGTTTTGTTGATTC
TTTGTATAGTTCTCTTGGTTTCTCCTTGGTTGATTTCAGTCCTGAGTTTCATTATTTCCTGCTGTCTACTCCTCTTGGGT
GCATTTCCTTCTTTTGTTCTACAGCTTTCAGATGAGCTATTAAGTTTCTAGTTATGATCTCTTCAGTTTCTTTATGGAGG
CACTCAGGGCTATGAGTTTTTCTCTTAGCACTGCTTTCATTGTGTCTGGTAAGATTAAGTATGTTGTGCCTTCATTTTCA
TTGAATTCCNAAAATGTANCCGTCTGCAGCCNCACTAACTGGGTTCCTGANTGGGANGCTGGAGCTGTATGGAANGAAAC
AGTGACNAAAATAATGGAGACCAAGACAATTTTTTCTGATCNNNGNNCNNNNGTTTACTNANANTGN
Sequence Type genomic DNA
Unitrap ID UNI27289

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 41499899..41500444 508
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059834 (Sclt1) NM_001081411 sodium channel and clathrin linker 1 Gene [Source:MGI Symbol;Acc:MGI:1914411]

 
Come back to gene ENSMUSG00000059834


For any suggestions or comments, please send an email to unitrap@crg.es