Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14805E12
Clone ID IST14805E12
Vector VICTR76
Project tigm

Sequence tag IST14805E12HMR1
Sequence
GCATGGGACCTGAGAAGCAGANAGCAGTTCATATTTGATAGGCTTATTTCCAGTGACTTGGGGGTGCTAGGCACCTCTGC
ATATACATAGACAAATAATCGTCTATAGACGAATGAGTTCTATGCCAACTGTTGCAACGATTTTACACTTCTCTTTTTAA
CGGATTATTTAATCCAGACCTAATATCTGATGCTTTATTCAGTTCTGAGTCCTGACTATGTGGGTTTGAGATTTTTCTAA
NAATANACNNTANAATTCTCTTGANANCCNTTNNTCATTATTTAAAGTTGTTTNAAAGTAA
Sequence Type genomic DNA
Unitrap ID UNI35386

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 67654412..67654711 276
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037720 (Tmem33) NM_028975 transmembrane protein 33 Gene [Source:MGI (curated);Acc:Tmem33]


Sequence tag IST14805E12HMF1
Sequence
ATGCAAGTTTACCCTGGTATCAGTGGCCCTAGAGTAAGCTTATCATGAAAGCAAGAACTTACACCTGCTTTAGTGCGAAC
AAGCGCCTCATACCAATTTCTAAAGGGGCTTTTGTATCTTAACTCTAATGCTCAGAAATAATTCTAATACCAAGACGTCA
CATATGTGGGTATGTGAACTGAAAGGAGTCTCACAATACACATTCTCATTAAATGTGGTGGCATTGTTTCTAGCTGGTGC
TTCCAATAAGCTGATTTTGAAACATATTCATGCATCTATCTGANGTTTTTAAATACTAGTTTTAANCNNTGTCACNGTTT
TTGTGCN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 67654090..67654415 316
NO GENE  

 
Come back to gene ENSMUSG00000037720


For any suggestions or comments, please send an email to unitrap@crg.es