Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13800A11
Clone ID IST13800A11
Vector VICTR74
Project tigm

Sequence tag IST13800A11BBF1
Sequence
CCCTCACCATTTTTCCTTCTCACCCTCGGGCCTCCACACCTCCAACCACCGTCATGGTCTCTATTTCAGTCTCTCTGGAG
CTTGTTATCTACCCGCTTTCCAAACCGGGAGTTCTGCGTGCCTTCTCTGCACATCAATATGTACATCGAAAATGTTGGGC
CAGTTCAACCAGTCTGGTTTAGGAAGGGGGAAAAAAAAAGGGGCNNNCCCNANGGN
Sequence Type genomic DNA
Unitrap ID UNI31718

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 52972606..52972820 203
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000059070 (Rpl18) NM_009077 ribosomal protein L18 Gene [Source:MGI (curated);Acc:Rpl18-001]

 
Come back to gene ENSMUSG00000059070


For any suggestions or comments, please send an email to unitrap@crg.es