Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14336E9
Clone ID IST14336E9
Vector VICTR74
Project tigm

Sequence tag IST14336E9HMF1
Sequence
GTGCACCTGCTTCAGGAAACACCTGGAAGTCGCTGCAGGTTACACATCAATCACCCATCAATGCACCCATTTACTAGTAA
TGGAAATCTACAGTAATGGAAGGAAAAAAATCCTGCCACATGGAACTCTAGATGTCAATGTTCAGGGAAGCCATAAACCC
AAAAGCCCAAAAGAGCCAATACAAATGGCCAG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6101543..6101733 191
 
EST/CDNA Est Name
  W36520.1 - AA716801.1


Sequence tag IST14336E9BBF1
Sequence
GTGCACCTGCTTCAGGAAACACCTGGAAGTCGCTGCAGGTTACACATCAATCACCCATCAATGCACCCATTTACTAGTAA
TGGAAATCTACAGTAATGGAAGGAAAAAAATCCTGCCACATGGAACTCTANATGTCAATGTTCAGGGAAGCCATAAACCC
AAAAGCCCAAAAGAGCCNATACAAATGGCCNACATGTGAAGCACGGCACATAGCCNCAAAAACACACACAAAGTTGAACC
TCCNAGGCNTTCTGCTTGCANAGCAAGCCAAATCCAGAAAAACATATACTGCTCAACTCTATGTAAGACACCTAAAATAA
NCAAACCCACAGANCAACCTATNNNNTGAGACCCCTGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6101543..6101899 331
 
EST/CDNA Est Name
  BE333928.1 - BX522846.1 - AA798321.1 - BY059641.1 - BY105429.1 - BY311923.1 - BY064813.1 - BF662190.1 - BY064589.1 - BY069174.1 - BY339406.1 - BY339665.1 - BY300835.1 - BY340465.1 - BY337260.1 - BY068921.1 - BY106111.1 - BY108661.1 - W36520.1 - BY708653.1


Sequence tag IST14336E9HMR1
Sequence
GCACCACTTGCCCTCTCTGCAGCCAAGCCAGAGGCTTGCTTTCTCACCGTCCTCACTAGCACTCTCATGACACTGAGCTG
TAGTATGGAGCTTCTCTGTGGTTCTGCTTGAATTTACCTGTGGTGGCATCTTTTCGTGTGCTCACTGGCCAN
Sequence Type genomic DNA
Unitrap ID UNI16792

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 6101396..6101546 151
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000046792 (Zfp787) NM_001013012 zinc finger protein 787 Gene [Source:MGI Symbol;Acc:MGI:1914359]

 
Come back to gene ENSMUSG00000046792


For any suggestions or comments, please send an email to unitrap@crg.es