Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14074F6
Clone ID IST14074F6
Vector VICTR74
Project tigm

Sequence tag IST14074F6HMF2
Sequence
CATTGATGCCTCCTCACAAACCTGTTTCANAAGGAGAGAGTCATGAAGCTAGCTCCCAAGCAGATAGGATGTTCCCTAGA
TGATACATGGGAAGTAACTGTTAAAAGACTTAAAATGCAAGGGCCAGAGCCCCAAAGACAGCCAGCCAGCCACTGGTACA
ACAGCAGTCTGCGATGTGGGCGTGCCCCTGCCTGGGAGCTCTGGTCTGGGTGGGGGCAGGGCAAAAGGGCCTATTCTTTC
CCAGCGTCCCTCAGCTGCTCCCAGCANACATTCCATCAAGATGACTCTCGCTAAGGGCGGGGCAGCCTGTAATGGCTGCT
TGGCCAGCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 154547474..154547801 324
 
EST/CDNA Est Name
  AV207189.1 - BY324044.1 - BY326687.1


Sequence tag IST14074F6BBF1
Sequence
TTTGGGGTGAATGAGTCTGTTTGAGGTAAACTGAAGTGAAACCAGATATTCAGGAAATGTCGAGTANAGTTGTGATTCTC
AAAGTTTGGTTTCTTAGCAATTAGCAGCAGTACCCAAAAGACTGCTGTGTATCTGTGTATATTCTTTGCTTACCTCAACT
CTCTGAACTATGGGGAGGAGTCCTATGGAGTGCTCACAAAAAGGGACCTAGCATAACTGCACTCTGACCCAGCAAGCACC
TGAATGAGTCAGATGCAGATATTTGCACCCAACCCATGGACAGAAACAGCTGACCTCTGTTGTTGAATTAGGGAAGGCTG
AAAGAAACTGANGACTCTGTANGAGGACCAGCAGTCTCANTTANTCTGGATCCCTGANANCTG
Sequence Type genomic DNA
Unitrap ID UNI4069

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 16086822..16087202 367
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041974 (2310008H04Rik) NM_146068 RIKEN cDNA 2310008H04 gene Gene [Source:MGI Symbol;Acc:MGI:1924834]

 
Come back to gene ENSMUSG00000041974


For any suggestions or comments, please send an email to unitrap@crg.es