Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13682D1
Clone ID IST13682D1
Vector VICTR74
Project tigm

Sequence tag IST13682D1BBF1
Sequence
CTGCTAAAGCAAAGTATTGTACAAGATAGGCTGTGTCAAACTAGCTGACCATGGTATTTGCAGGAAAAGTGTATTTATAT
TATAATCTCAAAGTCTTCTTTAAAAATTCTATGTGGGGCCGGGCGTGGTGGCACACGCCTTTAATCCCAGCACTTGGGAG
GCANAGGCNGGTGAATTTCTGANTTNNAANCCAGTCTGGTCNANNNANTNNNTTCCANGANNNCCAGGGN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST13682D1HMR1
Sequence
CAGGCTCTACTTCNCAGAAGTGAAACTTAAAAGTGTGAGCTTTTGTAAAGGTGTAGTGAATGGCAGGAAAGAACTGTGTC
TCANATGTCCCTGTTTTAGAAAGTAACGGCAAGAAATGTGAAATGCAGGTGCAGGTGGTGGGACAGGCTCAGGAAATGAA
CCACAGCCTGAGGGCATGTCTGCTGAGGTGGCTTCAAAGGAGGTTCCCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI6893

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 86352342..86352553 208
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020516 (Rps6kb1) NM_028259 ribosomal protein S6 kinase, polypeptide 1 Gene [Source:MGI (curated);Acc:Rps6kb1-001]

 
Come back to gene ENSMUSG00000020516


For any suggestions or comments, please send an email to unitrap@crg.es