Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST15007H8
Clone ID IST15007H8
Vector VICTR78
Project tigm

Sequence tag IST15007H8HMF2
Sequence
ACNNGNGNNGAAAGCTNCNGGCNATACNNAATANAAAATGGCTTGGCTGGCTGTGCCTGTGTTTTGTAGAAGTCCTTGAT
AAACAAAGGTGCACACATGTCATTAGATGCTACTAATGACGACTCAACCTGACAAGTAACTGCTGCTATGGCGGGAGTAC
TCAANNTGCTCCATGACCANCANCACANGANGGCNGCTTTNNTGCCCANTTNCC
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15007H8BBF1
Sequence
CCCAGAGTTTGGAACTTACTGTCTTCTTGGG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST15007H8HMR1
Sequence
TTAAAACCTGGACAAGCATCTACACATCTGCAGCAGATN
Sequence Type genomic DNA
Unitrap ID UNI2398

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 22022623..22022660 38
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027630 (AC121108.12) NM_030732 F-box-like/WD repeat-containing protein TBL1XR1 (Transducin beta-like 1X-related protein 1)(Nuclear receptor corepressor/HDAC3 complex subunit TBLR1)(TBL1-related protein 1) [Source:UniProtKB/Swiss-Prot;Acc:Q8BHJ5]

 
Come back to gene ENSMUSG00000027630


For any suggestions or comments, please send an email to unitrap@crg.es