Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14945D11
Clone ID IST14945D11
Vector VICTR76
Project tigm

Sequence tag IST14945D11HMF1
Sequence
GCTGTGGCGCACTTAGCTTCAANANGAGGGCANACCNGACN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser


Sequence tag IST14945D11HMR1
Sequence
TTATAATAATTGGATTGNGTGTTTTNANANGGGCTTANTGGANTTGGAAATTCCAGCAACAAACTGAGTTTATTGTTTTT
GAAGCATGTTATCCAGCTCTCTGGCAATGAAGTGCAGACTGCTAACTCTCCAAGCCATAGCTAGGAGTTATTGCTTTGTT
ACTGGGGTCCTCTTTGAAGCATTTTGTTCTACTATCTAAATGCAACTTTTGGGAAAAAATTAAAAT
Sequence Type genomic DNA
Unitrap ID UNI19977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164856528..164856753 214
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039804 (Ncoa5) NM_144892 nuclear receptor coactivator 5 Gene [Source:MGI (curated);Acc:Ncoa5-007]

 
Come back to gene ENSMUSG00000039804


For any suggestions or comments, please send an email to unitrap@crg.es