Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5844-NL
Clone ID PST5844-NL
Vector U3NeoSV1
Project escells

Sequence tag PST5844-NL
Sequence
CATGCTGTGCTACTAAAGCTCTACCCCAGTACCCTAGAAATCATTTCTGAGCAATGAATCCAGGCTGTGAGTAAGACAGG
CCCACAGGCAGACAGGCACACAGGCACATAAACACACAGGCACACAGAC
Sequence Type genomic DNA
Unitrap ID UNI15625

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 108648448..108648576 129
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032601 (Prkar2a) NM_008924 protein kinase, cAMP dependent regulatory, type II alpha Gene [Source:MGI Symbol;Acc:MGI:108025]

 
Come back to gene ENSMUSG00000032601


For any suggestions or comments, please send an email to unitrap@crg.es