Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14989G1
Clone ID IST14989G1
Vector VICTR80
Project tigm

Sequence tag IST14989G1BBF1
Sequence
CTATGACTCTGCTTGCGGGGAGAATCTGACACTGTCTTCTGGATAGGAAGTCTTTTTCTCTGTCTAGCCTCTTCAATAAA
GACATCTGCGTGTCCTCACCCCACCCACCTTGTCCCTGTTGGCCTCAGGGTGCTAGAAAGCCACCAGCCCAAATTACTCT
GTGTGGTAATCTGCGAGAATGACTTCATTCTCCCTTGGTGCTTCCCAGTCNAGGCTCCTTGCTTTANGGGCTCTCTTCTC
TAANATAGGTAAACACACTGTGGTTCCGTCCTGATGGGAAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100254479..100254764 280
 
EST/CDNA Est Name
  BU847519.1 - BU961641.1 - CN684419.1 - CD550816.1 - CF167820.1 - CA544212.1 - BY205790.1 - BY055165.1 - BY772579.1 - CN696758.1 - CD554879.1 - BY082568.1 - BI557474.1


Sequence tag IST14989G1HMR1
Sequence
NNNANNANTGTGAGCTGCCNTATGGCTTCTGGGAACTGGTCTGGGTCCTCTCCAAGAGCAGTAAGTGCTCTTAACTGCTG
AGACATTTCTCCAGCTCCGGATGGGAGGTCTTCACTTCAAATGGAGAAGCAGGTGGAGGCTCATAGTAGAGTCTCCTCTG
GAGAGGGCCACCCTTGCCCAGGAGGCGCTTCCTGTGGGTGAAGAGTCAGTCTAAGTCCTTGGAGGAAACTTTTTGTTTGG
GAATTTGGGAAGAAGAACCACAGGGCCGAATAGAAACCCAGCGTCTGACAGCTGGCTGGCCCAGTAACTCTCTGAAAGAA
AAAGGTAGTGAGATGGGGCGGGACAGGTCACTGGGATTTGTGTCTCAACAGATGACAGACACCCTGAGGTCTTTCTCTTG
GGA
Sequence Type genomic DNA
Unitrap ID UNI29544

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 100254079..100254473 393
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001552 (Jup) NM_010593 junction plakoglobin Gene [Source:MGI (curated);Acc:Jup-001]


Sequence tag IST14989G1HMF1
Sequence
CTATGACTCTGCTTGCGGGGAGAATCTGACACTGTCTTCTGGATAGGAAGTCTTTTTCTCTGTCTAGCCTCTTCAATAAA
GACATCTGCGTGTCCTCACCCCACCCACCTTGTCCCTGTTGGCCTCAGGGTGCTAGAAAGCCACCAGCCCAAATTACTCT
GTGTGGTAATCTGCGAGAATGACTTCATTCTCCCTTGGTGCTTCCCAGTCAAGGCTCCTTGCTTTAGGGGCTCTCTTCTC
TAAGATAGGTAAACACACTGTGGTTCCGTCCTGATGGGAAGATCTGGTAGTAAGAACCTCAGTCTTTANAATGTACCAGT
ACGCAGGCTCAACCTANCCCCAGTTCTCCATTCTGATGCCNGGTGCTGGGTTGGCAAAGGGGTCCNAATCANTCNNNCCT
AANAANANCATGCGCCNNCAAATNCTCCTTTGTGGGCNNNCTCTGGCTGACNNGCATNTCCTNNAANCTCTN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000001552


For any suggestions or comments, please send an email to unitrap@crg.es