Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14070D1
Clone ID IST14070D1
Vector VICTR74
Project tigm

Sequence tag IST14070D1HMR1
Sequence
GTGCTAAAAGTAAAAGTCACAGTGCAAGGTCTCACAAGTGGCCTCGAACTGAGGCAGATCCTGTGCCAAGTTTGTTAATG
AAAAGACCTTGTTTTCATGGCAGTGCACTAAGGAGAGTCACATGCAGAAAGAGGCTGGTGAAGAGCAGCTCCTCGCAGAG
GACACAGAAGCAGAAGGAGAGGATGCTAGTGCAGAGGAAGAAGCGGGAGGCGCTAGCTCAGAGGAAGTATGCTCTTCTCT
CCAGCTCCAGTAGCTCCAGTGAGAATGACCTCAGCAGCGATTCCTCGTCCAGCTCCTCCACCGATGGAGAAGAGGACCTG
TGTGCATCTGCCAGTGAGAACCCCAGCAACCCCGCTGCTCCCTCNNGTGANANNGCTGGANTGCAGTCNCACAGTGAAAC
TGTGCTCACACCCNGTTCTCAAGCN
Sequence Type genomic DNA
Unitrap ID UNI10851

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 70323525..70323948 406
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000032217 (Rnf111) NM_033604 ring finger 111 Gene [Source:MGI Symbol;Acc:MGI:1934919]


Sequence tag IST14070D1BBF1
Sequence
AGCACTCAGAACAGGCTGGGTATGNCNCACCGAGACNNCNTTATCCTCATCTGANNNNNCTGTATCAGAGCCCCCAAAAT
GGAGACTAGATGAGGGAGAAGACAGACACTCACTTAAGGAAGAGTCATTATCCTCATCACTCGNNGNCNCTAGCTGTTGT
CTGCGCCCTAGGATTTCCTGATTTTCTTTGACACAGTTCTGCACATATGAGGGGCCAGCCTGCTGGCTTTTGCGCTTTTT
TCTCACAACACCACTTTTTTCTTGTTCTTGCTGGTTGCCAGTCATGTCCTTCTCTTGTTTTTGAGAATCATCACACAGAT
GAGAGAATTCATTCCCCACTTTGCTATTAATCATCTCCACTTCTGCAGGGAAGCTCTTGGTGGCCCCTAGGGGCTGTGGG
TGCAGAAGGACCGCCTTCAGACTCTCCTGTGTAGTGGGCGCATCANGAGTCCCACTCTTCATAGCCNCTTTTNNGGTGTA
NAGCTCGTTAAATTCNNGANTCCATTGANACNTGGGGAAACTTNNNGGAANGGCCTAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000032217


For any suggestions or comments, please send an email to unitrap@crg.es