Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5073-NL
Clone ID PST5073-NL
Vector U3NeoSV1
Project escells

Sequence tag PST5073-NL
Sequence
CATGCCTTTAATTTTAACACTTGGGAGGCACAGGCAGGATCTCTGAGTTTAAGGCCAGCCTGGTCTAAATAATGAGTTCC
ATGATAGCCAGGATTACATAGATCTTATCTAGATGCCTCTCCCCTAATTATTTG
Sequence Type genomic DNA
Unitrap ID UNI5703

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 62252586..62252719 134
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020074 (Ccar1) NM_026201 cell division cycle and apoptosis regulator 1 Gene [Source:MGI Symbol;Acc:MGI:1914750]

 
Come back to gene ENSMUSG00000020074


For any suggestions or comments, please send an email to unitrap@crg.es