Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5078-NR
Clone ID PST5078-NR
Vector U3NeoSV1
Project escells

Sequence tag PST5078-NR
Sequence
CTGGGACGAATACTCCTTCAGGTGAGCTACATTCCCAGCCCCTTCATAATAACTATTCAAAATCAGTAAACAGATGAAGT
AAGCATACTTGCTGCAGGGTAAGATCCTATTAGGTAGGCTAATCATACAAGGTTTTATAGACTTCGCAGACTTGCCAGCA
AACTGAAGCATAAATATTTTTAATTAAGTTAGTTTTTACCAGTAGCTGGAAGTGTTTTTGACCATAGGATAAATTGCTAA
AGGTTGTGCTTCTCCAGGGAATGAC
Sequence Type genomic DNA
Unitrap ID UNI14839

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 31883010..31883270 242
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000001855 (Nup214) NM_172268 nucleoporin 214 Gene [Source:MGI (curated);Acc:Nup214-001]

 
Come back to gene ENSMUSG00000001855


For any suggestions or comments, please send an email to unitrap@crg.es