Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5069-NL
Clone ID PST5069-NL
Vector U3NeoSV1
Project escells

Sequence tag PST5069-NL
Sequence
AATGGTTTCCTTGGGTGGAGGCTGTATGCTTGTGCTGCTATGGCTCATGGCTTCATGGAATGAAGGAGCCTTATCTTTCT
CATTTGTGCAGCTTGGGGGCCCCAGGCCAATGGGATATTTGCATTGCACTGGGAGAGAATGGTGGTGACACTGGGTTATG
CTTAGCTTTGTGGCTGTCCTGAGTCTTGGTACACACATAGCTGTGGGCAGAAAGGCAAAGCTGTGCCAGGCGCTTAGCTC
AGCTCCCTCCATCCCAGGCCCCTCTAACTC
Sequence Type genomic DNA
Unitrap ID UNI42

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 51415705..51415974 270
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000020358 (Hnrpab) NM_010448 heterogeneous nuclear ribonucleoprotein A/B Gene [Source:MGI (curated);Acc:Hnrpab-003]

 
Come back to gene ENSMUSG00000020358


For any suggestions or comments, please send an email to unitrap@crg.es