Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST5615-NR
Clone ID PST5615-NR
Vector U3NeoSV1
Project escells

Sequence tag PST5615-NR
Sequence
TATTAAAGTAGGAGAGCACAGTGAGCCCCATTTAATATCACTAGCTTAGAAGGTTAACTGATGCCAGTCTTACTGCATCT
TTCTTTATACTGGCAACTTCTTTCTTCTGGACCATTGGGAAGTAAATAATGTATGTACTCTCATTTTTTCAGTACTTTTT
CAGCATG
Sequence Type genomic DNA
Unitrap ID UNI138

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 84317129..84317295 167
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000018697 (Aatf) NM_019816 apoptosis antagonizing transcription factor Gene [Source:MGI (curated);Acc:Aatf-001]

 
Come back to gene ENSMUSG00000018697


For any suggestions or comments, please send an email to unitrap@crg.es