Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10111H8
Clone ID IST10111H8
Vector VICTR76
Project tigm

Sequence tag IST10111H8BBR1
Sequence
TACATTTAATTAGGTCTAGTTTACAGTCTCAGAGGTCCAGTCCATTATCATCATGACTGGAAGCATGGCAAGGTTCAGGC
AGACATGGTACTGAAGGAGCCAAGAGTTCTACTTCTTGATCGGAAGGCAGCCAGGAAGAGACTCAGTCTTCTACGTTGGG
CTAAGCATGAGCACTGGGAGCTCTCAAAGCCCGCCTACACAGTGACACACTTCCTCTAACAAGGACACACCTCCTAATAA
TTCGGCTTTCCATGGGCCAAGCTTATTCAAACAACCACAGTGGCTCTACTTATACAAAATGTCTGCAGGTCAGGTCATGT
GAACTTTAATCTTTCAGGTATTTTGCTTTTAGCTCTAAACTGCGTCCCTTCATTATTTTCTTACATCTTTCATCACATGT
CCCTTTATTTCTCCTCATTCTTTGTACAGTAATCAGATGCCCCTGCTCTGCCTTTAGAAAATTCTTGTATATAGCCAATT
CCACATTGATTATCTGTGTCAGAAGTGTAGTTTTAAATTCCTGTTCCATTTAATTATTGAGTCAAAACAAATATAAACAT
ACTTTAACACATCCTTAGTCTGTGCCTTTTAGATACACATGGGAAGGTGTTG
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39476101..39476710 607
NO GENE  


Sequence tag IST10111H8BBF1
Sequence
GTAGTCCCTTATAAAAGTTGCCTTGGTCATGGTGACCCTTTGCAGCTAGGAAACCCTAACTATGACAGCTATGAAAAATA
AGGGCCCACACTCTTTGTTTTGTAAACAGAGGAAAAGGCATGAGGTTGGCATGGTGGGGATGTGGGGGGGGGTGTATAAT
TTGAATCCATTGTATGAAAATTTTTTCAATAAAAAGTTCTCACCAAAAAAAAAAAAAAAA
Sequence Type genomic DNA
Unitrap ID UNI31953

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 39476708..39476926 219
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000037386 (Rims2) NM_053271 regulating synaptic membrane exocytosis 2 Gene [Source:MGI Symbol;Acc:MGI:2152972]

 
Come back to gene ENSMUSG00000037386


For any suggestions or comments, please send an email to unitrap@crg.es