Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13983A3
Clone ID IST13983A3
Vector VICTR74
Project tigm

Sequence tag IST13983A3BBF1
Sequence
TTGANACCTGGACTGGACAGGGCTACTGCGGCAGAAGGCGGAGTTCATCCCCCACCTANAGTCANAANATGACACCAGCT
ACTTTGACAGTGAGTTGGGGGTAGGGAGAGACACAATGCCAGGTCCGAGTATAGAATGGGATCT
Sequence Type genomic DNA
Unitrap ID UNI31361

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 87444205..87444345 133
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000053693 (Mast1) NM_019945 microtubule associated serine/threonine kinase 1 Gene [Source:MGI (curated);Acc:Mast1-001]

 
Come back to gene ENSMUSG00000053693


For any suggestions or comments, please send an email to unitrap@crg.es