Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10231C6
Clone ID IST10231C6
Vector VICTR76
Project tigm

Sequence tag IST10231C6BBF1
Sequence
CAACCACATGGTGGCTCACAGCCATCTGTAACGAGATCTGT
Sequence Type genomic DNA
Unitrap ID UNI35390 UNI35391

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 10: 22911683..22911722 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 78883468..78883507 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 79969943..79969982 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000036461 (Elf1) NM_007920 E74-like factor 1 Gene [Source:MGI Symbol;Acc:MGI:107180]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 93204996..93205035 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 74838721..74838760 40
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039193 (Nlrc4) NM_001033367 NLR family, CARD domain containing 4 Gene [Source:MGI Symbol;Acc:MGI:3036243]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 81816368..81816407 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 104611386..104611425 40
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 148335593..148335632 40
NO GENE  

 
Come back to gene ENSMUSG00000039193


For any suggestions or comments, please send an email to unitrap@crg.es