Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone AD0848
Clone ID AD0848
Vector pGT0lxr
Project sanger

Sequence tag AD0848
Sequence
CCTCCCGATGGACCCAATGGTGATGAAGAGACCTCAGTTGTATGGGATGGGTACTCACCCCCACTCCCAGCCACAGCAGA
GCAGCCCATACCCAGGAGGCTCCTACGGTCCCCCAGGTGCACAGCGGTATCCCCTTGGCATGCAGGGCCGGGCTCCAGGG
GCCCTGGGAGGCTTGCAGTACCCGCAGCAGCAGATGCCACCGCAGTACGGACAGCAAGCTGTGAGTGGCTACTGCCAGCA
AGGCCAGCAGCCATACTACAACCAGCAGCAGCAGCCCTCGCACCTCCCGCCCCAGGCACAGTACCTGCAGCCGGCGGCGG
CGCAGTCCCAGCAGAGGTACCAGCCACAGCAGGACATGTCTCAAGAAGGCTATGGAACTAGATCTCAGCCTCCTCTGGCC
CCTGGAAAATCCAACCATGAAGACTTGAATTTAATTCAACAGGAAAGACCATCGAGTCTACCA
Sequence Type mRNA
Unitrap ID UNI2821

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 5040585..5127024 190
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000069729 (Arid1b) AT rich interactive domain 1B (SWI-like) Gene [Source:MGI (curated);Acc:Arid1b-001]

 
Come back to gene ENSMUSG00000069729


For any suggestions or comments, please send an email to unitrap@crg.es