Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14942D5
Clone ID IST14942D5
Vector VICTR76
Project tigm

Sequence tag IST14942D5HMF1
Sequence
CTCAATACGTGTAGGTCACTCCTTTACACCCCACCCTCATTTAGAGACACAGTAGTTCCCTCTTAACTCCCCTGTTGCTT
TCTGATGTTTCAGTTACCGGTGGCTAGGAGGGTCACATCCACATTTCTCTTATTACAGCGTAATATATATTCATCGTTTT
TCTATTGTTGTGGGTAATCCTCTGCTAAGAGTAATCCATCAGCTATTATAGATATTAATGTATAAGGGAGATCGCCCATA
TTTTACTGGGTTCNANTANTTCNAGGATTCCCACCATGAATCGTGGA
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 17201341..17201626 278
NO GENE  


Sequence tag IST14942D5HMR1
Sequence
NTTATAATAATTGGATTGTGTGTTTTTATATGGGCTNATTGGAGTTGGAAATTCCAGCAACAAACTGAGTTTATTGTTTT
TGAAGCATGTTATCCAGCTCTCTGGCAATGAAGTGCAGACTGCTAACTCTCCAAGCCATAGCTAGGAGTTATTGCTTTGT
TACTGGGGTCCTCTTTGAAGCATTTTGTTCTACTATCTAAATGCANCTTTTGGGAAAAAATTAAAAT
Sequence Type genomic DNA
Unitrap ID UNI19977

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 164856528..164856753 222
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000039804 (Ncoa5) NM_144892 nuclear receptor coactivator 5 Gene [Source:MGI (curated);Acc:Ncoa5-007]

 
Come back to gene ENSMUSG00000039804


For any suggestions or comments, please send an email to unitrap@crg.es