Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST1002-1
Clone ID PST1002-1
Vector U3NeoSV1
Project escells

Sequence tag PST1002-1
Sequence
CNTTTATCGGAACCACCCTCCATGTTGGTTCTGTCCTTTCTAAAAGCTTGATTCAAATCCTGATCTGANAAGGAGGGAGA
AACACATACCTTTCACCATCTACCCCATTTCCTCCTCTCCACTTCCTGCCCAAAGAGCCCGGATGCTGCATGGACGCCTC
AGAAAGCACATCCATTTTCTCCCTTCTTTCCCACTGCTCCTACAGGAGCAAAGGTGTCCGTCCGATCATTTATGTAACCA
GACCCCACACTNCCTTACATTGGACCCTTTGTTCCAGATAGGTGAAGGTGTGCCCGCTCTGCCCCGCCCCTTCTATTCAG
TCAAGACATCTTGCTATGGAGACCCATTCCAGGCGCCATTTTCTCCATCTGGTCTTTGCAACCCCTCCTATTGGAGGCCT
TNTCTTTCCATTTTG
Sequence Type genomic DNA
Unitrap ID UNI15629

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 2: 174119905..174120316 404
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000027523 (Gnas) NM_019690 GNAS (guanine nucleotide binding protein, alpha stimulating) complex locus Gene [Source:MGI (curated);Acc:Gnas-007]

 
Come back to gene ENSMUSG00000027523


For any suggestions or comments, please send an email to unitrap@crg.es