Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST13547B8
Clone ID IST13547B8
Vector VICTR74
Project tigm

Sequence tag IST13547B8HMR1
Sequence
GTGACNACTCANTGTGTTCTTANGTNNGGGTCTACCATGCTTTTGCTTTTATACCTTTTTAATTTTAATTTTAATTTTNN
TTCAATAATTTATTTATTTTTAATTCCCTTTACATCCCGATCGAGCCCCCACCTCTCCTCCCAGTCTCTCCCATTATCCC
CTCCCCCCTCTTCTCAGAGAAGGGGAAGCCCCCTTGGGTATCACTCCCCCACGGGATGCCAAAGTCCCAGCAGGACCAGT
TACATCATCTCCTGCTGAGGCCCAACCAGGAAGTCCAGGTAGGGGAAGGGAAGCCAACATCCAATGGCAGGTAAGAGAGT
CAGAGACAGCCCCAGGCTGATCCACTTGAAGACCAAGCTGCACATCTGCTACAAACAGGGGGCCTTGCGCCAGCCAACTT
TATTTTATTTTGAGACGGGGTCTCTCGTAGCTTANGCTGGCCTTAGAAGTCACTGTGTGGCTGAGGATGACCTTGAACCC
CTGATCCTCCTGACTTCCCCTCCCAAGTGCAGGGATTACAGGCTGTGCTGCTGTGCACTGTTGATTCCNTGCTGGGATTG
ATCCTAGCCNANGGCTTCNTACAGGCTNGNTCC
Sequence Type genomic DNA
Unitrap ID UNI2407

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 123036724..123037315 562
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000031822 (Gse1) NP_941073 genetic suppressor element 1 Gene [Source:MGI (curated);Acc:Gse1-002]


Sequence tag IST13547B8BBF1
Sequence
NTCNTGGCANANAGAGGTGAGTCTGGGGGTGGAAGCCNCTGAGGAGCAGGGTCCNGCTNACAGTGAGATACACAGGGCTC
TCANTCTNANTTCCTGAANGCTGGGCNACNCTTGGTCTGCTGTCCTCCCAAATCTCANTTGGANAATTCANGTANNCNNN
NNAAANGATGGGGTCCCCTCCAGGACNGGGCANTGTTNTGGGGGCNAGGTGGGGGGAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser

 
Come back to gene ENSMUSG00000031822


For any suggestions or comments, please send an email to unitrap@crg.es