Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST10713C3
Clone ID IST10713C3
Vector VICTR76
Project tigm

Sequence tag IST10713C3BBF1
Sequence
GATCGATAGCATCCAGACCCACAGGCTGCAAGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGANAN
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56863048..56863139 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]


Sequence tag IST10713C3HMF1
Sequence
GATCGATAGCATCCAGACCCACAGGCTGCAAGGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGAGA
GAGAGAGAGAGANANAN
Sequence Type genomic DNA
Unitrap ID UNI7146

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 4: 56863048..56863139 92
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000038816 (Ctnnal1) NM_018761 catenin (cadherin associated protein), alpha-like 1 Gene [Source:MGI (curated);Acc:Ctnnal1-001]

 
Come back to gene ENSMUSG00000038816


For any suggestions or comments, please send an email to unitrap@crg.es