Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14613C9
Clone ID IST14613C9
Vector VICTR74
Project tigm

Sequence tag IST14613C9BBF1
Sequence
CACTTTGACACCAAACATGGGAGATACAGAATTTGAAGTTTTTGGTCTTATTCTCATCCAGTACTTCCTCATTGTGCTGT
TTTCTCCCTTTTGGAATAGTAATGTATATCCTTTGCCCTTGCAAGTTGGAAGTGTGCGATCTGCTTATTGGAGCCAGAGA
GTAGAATGTGGTGGTTTGAATGAGAATGTCTGCCACAGGCTCACAGATCTGT
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60648917..60649127 211
NO GENE  


Sequence tag IST14613C9HMR1
Sequence
GCTCTTCAGATCTCCAGCTCCTTTCAGTTCTGTTC
Sequence Type genomic DNA
Unitrap ID UNI1243

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60649127..60649160 34
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000042569 (Dhrs7b) NM_145428 dehydrogenase/reductase (SDR family) member 7B Gene [Source:MGI (curated);Acc:Dhrs7b-001]


Sequence tag IST14613C9HMF1
Sequence
CACTTTGACACCAAACATGGGAGATACAGAATTTGAAGTTTTTGGTCTTATTCTCATCCAGTACTTCCTCATTGTGCTGT
TTTCTCCCTTTTGGAATAGTAATGTATATCCTTTGCCCTTGCAAGTTGGAAGTGTGCGATCTGCTTATTGGAGCCAGAGA
GTAGAATGTGGTGGTTTGAATGAGAATGTCTGCCACAGGCTCACAGATCTGAATACTTAGTCACCACAGAGTGGTACTAT
TTAAAAGGATTAGGAAGTGTGGCCTTGTTGGAGGAAGTATGTCATGGGGCAGGCGTGTGTGTGTGTGTGTGTGTNTNNCN
GANATTNNAAN
Sequence Type genomic DNA

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 60648802..60649127 316
NO GENE  

 
Come back to gene ENSMUSG00000042569


For any suggestions or comments, please send an email to unitrap@crg.es