Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone IST14870A2
Clone ID IST14870A2
Vector VICTR76
Project tigm

Sequence tag IST14870A2HMR1
Sequence
NNCGAGGACAACATGTATTGGACATATACTGCAGTGCTATTTACAAAGTCTACCTAGTGAATCTTAAAGCGATTTTATTT
TGTGTGTGTGTGTGTGTGTGTGTGTGTNTN
Sequence Type genomic DNA
Unitrap ID UNI13864

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 107685922..107686026 105
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000044881 (Chchd8) NM_183270 coiled-coil-helix-coiled-coil-helix domain containing 8 Gene [Source:MGI (curated);Acc:Chchd8-001]


Sequence tag IST14870A2HMF1
Sequence
TTAGTCATTGTTTGTTACCTATTTCAATTGTTTATTTTTAGCATATTTGGCTACCATGTTTATCTTGTACCAACAGGATC
CTTACTACAGATTTAATGACCTGAACTATAGATGGATTTCCTTAGATAACTGGACCTACAGCACGGAATTTAAAATCCCC
TTTAATCTCAGGTATGTATATTTTTATATATACTATACTAATATACTACATCCATATATACTATATATACTATGTCCATA
TATACTATAGTATATATACTATGCCCATAGATACTATGTACTATATAGTATATTATAGGGCTGGCAAGATGGCTCAGTGG
TTAAGAGCGCCGACTGCTCTTCCNAANGTCCTGAGTTCAAATCCCANCAACCATGTGGTGNCTCACAACCATCCATANTG
AAATCTGATGCCCTCTTCTGGAGTATCTGAANACNGCTACNNTGTACTTNCNNTNAAN
Sequence Type genomic DNA
Unitrap ID UNI26060

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135169798..135170245 430
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]


Sequence tag IST14870A2BBF1
Sequence
ATAGTCATTGTTTGTTACCTATTTCAATTGTTTATTTTTAGCATATTTGGCTACCATGTTTATCTTGTACCAACAGGATC
T
Sequence Type genomic DNA
Unitrap ID UNI7878

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 3: 135169797..135169876 80
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000028164 (Manba) NM_027288 mannosidase, beta A, lysosomal Gene [Source:MGI (curated);Acc:Manba-001]

 
Come back to gene ENSMUSG00000028164


For any suggestions or comments, please send an email to unitrap@crg.es