Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9449-NR
Clone ID PST9449-NR
Vector U3NeoSV1
Project escells

Sequence tag PST9449-NR
Sequence
GTATGGACCTGCTGCTTTCTTTCTGAATAGAAAGAACAAGGTTTGCTCTTACCATTAAAGAGACATG
Sequence Type genomic DNA
Unitrap ID UNI15635

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 40612451..40612517 67
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000015656 (Hspa8) NM_031165 heat shock protein 8 Gene [Source:MGI (curated);Acc:Hspa8-009]

 
Come back to gene ENSMUSG00000015656


For any suggestions or comments, please send an email to unitrap@crg.es