Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9261-NR
Clone ID PST9261-NR
Vector U3NeoSV1
Project escells

Sequence tag PST9261-NR
Sequence
AGACAGAACCTTTAAAATAGTTGGTTTGTTGCATGGATAGGCAGTCTCACTGGGATTCAGAGGTCTAGAAACAGACACAG
TTCCACATGAAAATGTATTGTCAGTGGTGGCATTCCACTGAAATATGACATTAATGATTGAGACTTCAATAGATAAGACT
GGGATGGCTGCAGGCATCTGGGAAAGATAAGTTTGAGTCTATTATGAAGAGCTAGGAAAAGTTTACCGGTTTTCTTTATA
ATTTTGGAGTGGGAAAGATCATTTCCTTTTTTTGCGATACCTGG
Sequence Type genomic DNA
Unitrap ID UNI14906

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 10691909..10692183 269
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024740 (Ddb1) NM_015735 damage specific DNA binding protein 1 Gene [Source:MGI Symbol;Acc:MGI:1202384]

 
Come back to gene ENSMUSG00000024740


For any suggestions or comments, please send an email to unitrap@crg.es