Tools for the biologist enabling optimized use of gene trap clones

  Homepage | Blast Search | GO Search | Advanced Search | About


Clone PST9026-NR
Clone ID PST9026-NR
Vector U3NeoSV1
Project escells

Sequence tag PST9026-NR
Sequence
GTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGTGATGTGTGTGT
Sequence Type genomic DNA
Unitrap ID UNI15641 UNI15642 UNI15643 UNI15644 UNI15645

MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 19: 57813448..57813500 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 18: 3427465..3427517 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000024231 (Cul2) NM_029402 cullin 2 Gene [Source:MGI Symbol;Acc:MGI:1918995]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 17: 25994517..25994569 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000073434 (Wdr90) WD repeat domain 90 Gene [Source:MGI Symbol;Acc:MGI:1921267]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 16: 73902239..73902291 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000052516 (Robo2) NP_780758 roundabout homolog 2 (Drosophila) Gene [Source:MGI (curated);Acc:Robo2-004]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 15: 103347823..103347875 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 12: 71339274..71339326 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 11: 4351991..4352043 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 9: 8225431..8225483 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 14: 72807947..72807999 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 8: 93325013..93325065 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 6: 34509161..34509213 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 7: 56091324..56091376 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 5: 34892941..34892993 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000054520 (Sh3bp2) NM_011893 SH3-domain binding protein 2 Gene [Source:MGI (curated);Acc:Sh3bp2-001]
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr X: 49016328..49016380 53
NO GENE  
Other possible mapping
MAP Chromosomal Location Alignment Score Ensembl Browser UCSC Genome Browser
  Chr 1: 22327000..22327052 53
 
GENE Ensembl ID (Gene Symbol) RefSeq ID Description
  ENSMUSG00000041670 (Rims1) regulating synaptic membrane exocytosis 1 Gene [Source:MGI Symbol;Acc:MGI:2152971]

 
Come back to gene ENSMUSG00000041670


For any suggestions or comments, please send an email to unitrap@crg.es